Journal: Molecular Therapy. Nucleic Acids

Article Title: Nitric oxide-dependent stabilization of vimentin confers chemoresistance in ovarian cancer

doi: 10.1016/j.omtn.2026.102924

Figure Lengend Snippet: iNOS increases sensitivity to cisplatin in ovarian cancer (A) The cell viability of OVCAR8 cells was assessed using RealTime-Glo MT Cell Viability Assay after culturing in increasing concentrations of cisplatin for 72 h. (B) OVCAR8 cells incubated with or without L-NMMA for 48 h, measured by RealTime-Glo MT Cell Viability Assay. (C) Cell viability after either no treatment (control), cisplatin, and a combination of cisplatin and L-NMMA by RealTime-Glo MT Cell Viability Assay. (D) Western blot analysis of vimentin protein expression in ovarian cancer cell lines. (E) Ovarian cancer cell lines were analyzed for VIM mRNA levels by qPCR. (F) OVCAR8 cells were treated with or without L-NMMA (4, 6, 8, and 10 mM) for 48 h, and western blot was used to analyze the effect of L-NMMA on the vimentin protein expression. B-actin was used as a loading control. Band densities were quantified using ImageJ analysis. Error bars, SEM. ∗ p < 0.05; ∗∗ p < 0.01 (compared with the control group, using two-way ANOVA). All experiments were independently repeated three times.

Article Snippet: The following primers for TaqMan Gene Expression Assay were purchased from Thermo Fisher Scientific; human VIM (Cat. #Hs00958111_m1) and human NOS2 (Cat. #Hs01075529_m1).

Techniques: Viability Assay, Incubation, Control, Western Blot, Expressing

Journal: Molecular Therapy. Nucleic Acids

Article Title: Nitric oxide-dependent stabilization of vimentin confers chemoresistance in ovarian cancer

doi: 10.1016/j.omtn.2026.102924

Figure Lengend Snippet: iNOS knockout increased chemosensitivity and impaired cell motility and migration of ovarian cancer cells (A) Immunoblotting showing reduced iNOS (left) and vimentin (right) expression levels following NOS2 knockdown in the OVCAR8 cells. (B) NOS2 knockdown sensitized OVCAR8 cells to cisplatin, reducing its IC 50 value. Log-logistic model was used to analyze the data. The group comparison between control group and KO-1 had a p value = 8.98e-07. The comparison between control and KO-2 had a p value = 0.0132. The detected EC50 for control group was 0.8554, for KO-1 was 0.6037, for KO2 was 0.7688. (C and D) Analysis of reduced protein (left) and mRNA (right) expression of iNOS and vimentin following siRNA transfection in OVCAR8 and A2780cis cells for 72 h, assessed by western blot and RT-qPCR. (E) OVCAR8 cells were transfected with 2 different siRNAs or the scramble siRNA and were assessed for migration using the scratch wound assay. The area of the wound was measured at 0, 12, 24, and 36 h by the IncuCyte live-cell analysis system. Two-way repeated measures ANOVA was used to analyze the data. After 6 h, siRNA1 had p value = 1, siRNA2 had p value = 0.23. After 12 h, siRNA1 had p value = 0.71 and siRNA 2 had p value = 0.16. After 24 h, siRNA1 had a p value = 0.39 and siRNA2 had a p value = 0.05. After 36 h, siRNA1 had a p value = 0.86 and siRNA2 had a p value = 0.04. (F) NOS2 KO-1 and KO-2 OVCAR8 cells formed significantly fewer colonies compared to parental OVCAR8. The experiment was performed in triplicate with three biological replicates. Statistical analysis was conducted with two-way ANOVA. ∗ p < 0.05 and ∗∗ p < 0.01. (G) Silencing of NOS2 by two different siRNAs significantly reduced the number of colonies formed by OVCAR8 cells. Clonogenic growth was measured after 10 days, quantified using ImageJ, and represented as a bar graph (mean ± SEM). The experiment was performed in triplicate with three biological replicates. Statistical analysis was conducted with two-way ANOVA. ∗ p < 0.05 and ∗∗ p < 0.01. All experiments were independently repeated two to three times.

Article Snippet: The following primers for TaqMan Gene Expression Assay were purchased from Thermo Fisher Scientific; human VIM (Cat. #Hs00958111_m1) and human NOS2 (Cat. #Hs01075529_m1).

Techniques: Knock-Out, Migration, Western Blot, Expressing, Knockdown, Comparison, Control, Transfection, Quantitative RT-PCR, Scratch Wound Assay Assay, Cell Analysis

Journal: Molecular Therapy. Nucleic Acids

Article Title: Nitric oxide-dependent stabilization of vimentin confers chemoresistance in ovarian cancer

doi: 10.1016/j.omtn.2026.102924

Figure Lengend Snippet: L-NMMA promotes vimentin destabilization by enhancing its ubiquitination (A) CHX chase assay showing vimentin protein levels in OVCAR8 cells treated with 10 mM L-NMMA at different time points. (B) Vimentin ubiquitination was assessed in OVCAR8 cells treated with L-NMMA for 24 h, in the presence of the proteasome inhibitor MG-132 (10 μM) for the final 4 h, followed by immunoprecipitation and western blot using an anti-ubiquitin antibody. (C) Measurement of vimentin S-nitrosylation levels was performed by immunoprecipitation in OVCAR8 cells. (D) Western blot analysis of vimentin expression in OVCAR8 cells treated with 10 mM L-NMMA alone or in combination with MG132 at 1, 5, or 10 μM. (E) Tumor growth and proliferation were monitored in mice bearing parental and NOS2 KO OVCAR8 tumors, evaluated by ROI measurements every 4 days ( n = 6). (F) Kaplan-Meier survival curves of mice bearing parental and NOS2 KO OVCAR8 tumors following cisplatin treatment ( n = 6). Data are presented as mean ± SEM. Statistical analysis was performed using two-way ANOVA for growth curves and the Kaplan-Meier method for survival analysis ( p < 0.05, ∗ p < 0.01). Experiments were performed in duplicate or triplicate.

Article Snippet: The following primers for TaqMan Gene Expression Assay were purchased from Thermo Fisher Scientific; human VIM (Cat. #Hs00958111_m1) and human NOS2 (Cat. #Hs01075529_m1).

Techniques: Ubiquitin Proteomics, Immunoprecipitation, Western Blot, Expressing

Journal: iScience

Article Title: Electromagnetic exposure changes human Schwann cell motility and transcriptomic profile of hearing-loss-related genes

doi: 10.1016/j.isci.2026.115130

Figure Lengend Snippet: Validation of coding and non-coding DEGs (A) Expression of some modified coding DEGs ( RPLP1, SPTAN1, ARPC2, COL4A1, and LAMC1 ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001. One-way ANOVA using Sidak’s post-test. (B) Expression of 2 modified non-coding RNAs ( VIM-AS1 and CYTOR ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05. One-way ANOVA using Sidak’s post.

Article Snippet: VIM-AS1 FW: ATGTGAGGCCCAGGCATTGA RV: ACTAGTACACCCCCGACGTGTT , Merck Life Science, Milan, Italy , –.

Techniques: Biomarker Discovery, Expressing, Modification, Quantitative RT-PCR, Control